Peanut Marker Database

AHGS1217 Information

Marker name AHGS1217
Marker category Genome-SSR
Primer sequences Fw TGTTCATCAAAAGCCTTCCA
Rv CCCAATGATGCACAATTCAA
EST/Genome sequences SACT10J18
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.1
Position 32.004
NYF2 Linkage LG02.1
Position 65.187
BF6 Linkage BB03
Position 15.036
TF6 Linkage TA09
Position 57.851
Integrated consensus map Linkage B02
Position 86.575
Integrated consensus map Linkage B03
Position 51.13
Integrated consensus map Linkage B09
Position 94.566
Integrated consensus map Linkage A09
Position 55.901
SNP Position
Method
SSR Fragment size 232
Pattern* AG
Repeat count 31
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea