Peanut Marker Database

AHGS1208 Information

Marker name AHGS1208
Marker category Genome-SSR
Primer sequences Fw TGTTGATGAACGAAATGGGA
Rv TCCAGAGCAACTGGACAATG
EST/Genome sequences KICT12H02
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.2
Position 64.488
BF6 Linkage BB07
Position 56.336
BF6 Linkage BB04
Position 55.329
Integrated consensus map Linkage A09
Position 105.268
Integrated consensus map Linkage B04
Position 99.592
Integrated consensus map Linkage B07
Position 73.372
SNP Position
Method
SSR Fragment size 271
Pattern* AC
Repeat count 32
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea