Peanut Marker Database

AHGS1193 Information

Marker name AHGS1193
Marker category Genome-SSR
Primer sequences Fw GATCGGAGATCGGAGAAACA
Rv CTGTAGCTCCACAATCGGGT
EST/Genome sequences KICT09K08
Lines
PIC Value
Lines
Map SKF2 Linkage LG01.1
Position 21.798
NYF2 Linkage LG01.1
Position 0.0
NYF2 Linkage LG02.1
Position 36.762
BF6 Linkage BB02
Position 13.429
BF6 Linkage BB06
Position 0.52
BF6 Linkage BB10
Position 20.375
Integrated consensus map Linkage B02
Position 62.046
Integrated consensus map Linkage B06
Position 69.798
Integrated consensus map Linkage B10
Position 61.206
Integrated consensus map Linkage A01
Position 62.732
SNP Position
Method
SSR Fragment size 252
Pattern* AG
Repeat count 33
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea