Peanut Marker Database

AHGS1183 Information

Marker name AHGS1183
Marker category Genome-SSR
Primer sequences Fw CCAAACCATTGAGAAGCGAT
Rv GTGTTAGACGGCCAAAGAGG
EST/Genome sequences SACT13L03
Lines
PIC Value
Lines
Map NYF2 Linkage LG03.2
Position 76.006
AF5 Linkage AA02
Position 9.58
AF5 Linkage AA04
Position 22.614
Integrated consensus map Linkage A04
Position 33.04
Integrated consensus map Linkage A02
Position 30.912
Integrated consensus map Linkage A03
Position 71.299
SNP Position
Method
SSR Fragment size 225
Pattern* AG
Repeat count 33
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea