Peanut Marker Database

AHGS1165 Information

Marker name AHGS1165
Marker category Genome-SSR
Primer sequences Fw TGTGGAACGTCCTGAGAAGA
Rv GTGCTTAAAGCCAGGACAGC
EST/Genome sequences KIAC08L08
Lines
PIC Value
Lines
Map AF5 Linkage AA09
Position 14.498
BF6 Linkage BB01
Position 13.607
TF6 Linkage TB01
Position 38.238
TF6 Linkage TA09
Position 34.253
Integrated consensus map Linkage A09
Position 78.84
Integrated consensus map Linkage B01
Position 40.896
SNP Position
Method
SSR Fragment size 273
Pattern* AG
Repeat count 34
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea