Peanut Marker Database

AHGS1159 Information

Marker name AHGS1159
Marker category Genome-SSR
Primer sequences Fw CCTCATCAGAGATCGTTAACTCAA
Rv TTCATTCCAAAAGTTGAGAGACA
EST/Genome sequences SACT06O13
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.3
Position 27.979
AF5 Linkage AA02
Position 26.811
BF6 Linkage BB02
Position 15.636
TF6 Linkage TA02
Position 55.845
Integrated consensus map Linkage B02
Position 65.249
Integrated consensus map Linkage A02
Position 47.955
SNP Position
Method
SSR Fragment size 295
Pattern* AG
Repeat count 34
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea