Peanut Marker Database

AHGS1148 Information

Marker name AHGS1148
Marker category Genome-SSR
Primer sequences Fw CTTTCGAACAGCACGATGAG
Rv CTCTTGCTGTTTGCTTGTCG
EST/Genome sequences KICT01A09
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 54.029
TF6 Linkage TA09
Position 35.145
TF6 Linkage TB03
Position 71.341
Integrated consensus map Linkage B03
Position 65.414
Integrated consensus map Linkage A09
Position 80.131
SNP Position
Method
SSR Fragment size 172
Pattern* AG
Repeat count 35
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea