Peanut Marker Database

AHGS0648 Information

Marker name AHGS0648
Marker category Genome-SSR
Primer sequences Fw CCTTTCTCCTACCGAGTCCC
Rv TCATGCATGCCTATTTCCAA
EST/Genome sequences AHGS40A10
Lines
PIC Value
Lines
Map SKF2 Linkage LG06.1
Position 46.524
TF6 Linkage TA02
Position 58.102
Integrated consensus map Linkage A10
Position 70.892
Integrated consensus map Linkage A02
Position 50.471
SNP Position
Method
SSR Fragment size 241
Pattern* AC(mis1)
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea