Peanut Marker Database

AHGS0457 Information

Marker name AHGS0457
Marker category Genome-SSR
Primer sequences Fw CAGCCAGCACTCCTCTTTTC
Rv AGTCACGAGACCCACTGTCC
EST/Genome sequences AHGS45D16
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.2
Position 76.02
TF6 Linkage TA09
Position 44.199
TF6 Linkage TA05
Position 40.926
Integrated consensus map Linkage A05
Position 21.352
Integrated consensus map Linkage A09
Position 65.005
SNP Position
Method
SSR Fragment size 269
Pattern* AC
Repeat count 13
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea