Peanut Marker Database

AHGS0347 Information

Marker name AHGS0347
Marker category Genome-SSR
Primer sequences Fw AACCAGTATCCCTTCCGCTT
Rv AGTTTGTTGCCAGTTTCGCT
EST/Genome sequences AHGS48N22
Lines
PIC Value
Lines
Map NYF2 Linkage LG04.2
Position 4.121
AF5 Linkage AA04
Position 57.759
BF6 Linkage BB04
Position 49.619
TF6 Linkage TA04
Position 94.926
Integrated consensus map Linkage B04
Position 94.141
Integrated consensus map Linkage A04
Position 81.325
SNP Position
Method
SSR Fragment size 269
Pattern* AC
Repeat count 17
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea