Peanut Marker Database

AHGS0212 Information

Marker name AHGS0212
Marker category Genome-SSR
Primer sequences Fw TGGTTCCTTTCCTTCCTTCA
Rv AACATCTGCCAAATGCAACA
EST/Genome sequences AHGS47I01
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.1
Position 67.56
TF6 Linkage TB02
Position 25.743
TF6 Linkage TB04
Position 66.172
TF6 Linkage TA10
Position 8.188
Integrated consensus map Linkage A10
Position 92.878
Integrated consensus map Linkage B02
Position 67.758
Integrated consensus map Linkage B04
Position 119.479
SNP Position
Method
SSR Fragment size 255
Pattern* AC
Repeat count 24
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea