Peanut Marker Database

AHGS0208 Information

Marker name AHGS0208
Marker category Genome-SSR
Primer sequences Fw TGTAATCCTTGCTGTGGTGG
Rv GAAGCCTTCTCACGGTTCTG
EST/Genome sequences AHGS40I24
Lines
PIC Value
Lines
Map BF6 Linkage BB08
Position 22.113
TF6 Linkage TA08
Position 76.068
TF6 Linkage TB08
Position 25.489
Integrated consensus map Linkage B08
Position 67.061
Integrated consensus map Linkage A08
Position 90.877
SNP Position
Method
SSR Fragment size 289
Pattern* AG
Repeat count 24
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea