Peanut Marker Database

AHGS0134 Information

Marker name AHGS0134
Marker category Genome-SSR
Primer sequences Fw GAATCTGCTGTGGACCGTCT
Rv GCAGATGGAGAAGCCATGA
EST/Genome sequences AHGS40D23
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.2
Position 76.872
BF6 Linkage BB04
Position 46.993
TF6 Linkage TA04
Position 90.994
TF6 Linkage TB04
Position 42.154
Integrated consensus map Linkage B04
Position 92.314
Integrated consensus map Linkage A04
Position 82.984
SNP Position
Method
SSR Fragment size 235
Pattern* AG
Repeat count 36
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea