Peanut Marker Database

AC3C02 Information

Marker name AC3C02
Marker category Publicly available markers
Primer sequences Fw TCTAACGCACACAAATCGAA
Rv CTTGTACCTGCGCCATTCT
EST/Genome sequences DQ099133
Lines
PIC Value
Lines
Map BF6 Linkage BB10
Position 20.519
Integrated consensus map Linkage B10
Position 61.535
Integrated consensus map Linkage A10
Position 91.39
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0390

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea