Peanut Marker Database

AC2C02 Information

Marker name AC2C02
Marker category Publicly available markers
Primer sequences Fw CTTCGACGGAAGATCGTATTT
Rv GGGTGCTATAATGGCTGAACT
EST/Genome sequences DQ099127
Lines
PIC Value
Lines
Map BF6 Linkage BB10
Position 21.818
Integrated consensus map Linkage B06
Position 111.795
Integrated consensus map Linkage B10
Position 62.026
Integrated consensus map Linkage B05
Position 51.022
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0383

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea