Faba bean Marker Database

original sequence
>VfEES11G02 
AAAGGACAATTAACGGCAAATTTCTGATTTTGAGAGGAGACAACAGTGCGCTTGATATTC
GCTATCTCACTAGATCTAAAATAATTCCAATAGCAAAGGACAAGCAAAGTGAAATGAATA
ATAGCTTAGCTTCTTCTGTTAGTCGATTTTACCTTTTACTCCTTTCTCAGCATGCCTTTA
CTCTTCTTTTTTCAATTGCCATGATGCAGTGTCTTCTTTAGATTCATTAGCAATGAAAAA
AACCTCAAAACTTCAAAATCATCAACAATGGCAGCAGAAAGGATAAAGAAAGCCATATCA
AATGGTATCTCTCCAGTGATTTAGCGGAGGAAATGGCCAAATAACCGTTGGAGGAGGTCG
GAGGCTGCGGCGGCGCACCAGCACCAGATCCACTGGTACCATTTTTAGCGGCGTCGTTGG
AAGGAGGACTCGAAGTAGAAGACGACGAAGAAGACAAAGAAAATCCAAGGTTATAAGCAG
GACTACCATCCGGCTTAAACAATCCATAATTCCTCTCAGAAGTTGGTCCAGGTTTCATAT
TCTCATTAAAAAGGGCAAAAACGTAAATATTCAAATCCGAATCCGGTTTCAACGGCGTTC
CTTTCTTACTACTCAACTTGATCACATTTCCGGTATACTTCCTCGCATTCTCCACCGTCG
CACCGACTTCATCTTCATC


MarkerDB | Vicia faba