Marker name | FBES1741 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TTTCTCATGGGGTTCATGGT | |
Rv | CATGCTCACAGGCACAAGAT | ||
EST/Genome sequences | VfRES11O17 | ||
Lines | |||
PIC | Value | ||
Lines | |||
SNP | Position | ||
Method | |||
SSR | Fragment size | 90 | |
Pattern* | GGC(mis2) | ||
Repeat count | 5 | ||
Method | PCR | Modified Touchdown [Sato et al. DNA Research 12, 301–364 (205)] | |
Detection | |||
Multiplex | |||
Gel image |
FBES1665-1744.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.