Faba bean Marker Database

FBES0873 Information

Marker name FBES0873
Marker category EST-SSR
Primer sequences Fw TCAAGTACCACCAATGGCAA
Rv GATAACCCATCTTTCCCGGT
EST/Genome sequences VfPES05M14
Lines
PIC Value
Lines
SNP Position
Method
SSR Fragment size 241
Pattern* AAAG(mis2)
Repeat count 4
Method PCR Modified Touchdown [Sato et al. DNA Research 12, 301–364 (205)]
Detection
Multiplex
Gel image FBES0769-0896.ppt [download]
Enzyme
Related markers Marker name
Species
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Vicia faba