| Marker name | Z30817 | ||
|---|---|---|---|
| Marker category | R-EST | ||
| Primer sequences | Fw | ACGTGTTGTCCGCTGTCAGA | |
| Rv | CGCCCCGGAGATTTATGTC | ||
| EST/Genome sequences | |||
| Map | GHRI | Linkage | LG4 |
| Position | 82.6 | ||
| SSR | Fragment size | 172 | |
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Comments | Botella et al. (1997) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.