Marker name | RSS1188 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TGCCTTCCGAGAAAGAAGAA | |
Rv | GGAAGAGAGAAAAAGAGAAGGCA | ||
EST/Genome sequences | RSCL03E10 | ||
SSR | Fragment size | 244 | |
Pattern* | AAG(mis1) | ||
Repeat count | 7 | ||
Method | PCR | ||
Detection | |||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.