Radish Marker Database

RSS1037 Information

Marker name RSS1037
Marker category EST-SSR
Primer sequences Fw TAGTCCCATTCCAGCTCCAC
Rv TTCATGCAGTTCTGGTGCTC
EST/Genome sequences RSCS14E06
SSR Fragment size 213
Pattern* AAC(mis2)
Repeat count 5
Method PCR
Detection
Comments
KDRI

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Raphanus sativus