| Marker name | RSS0541 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | GTTTTGAATTTTCCCGGGTT | |
| Rv | ATCTCCGTCAACAAATTCGG | ||
| EST/Genome sequences | RSCS09B08 | ||
| SSR | Fragment size | 236 | |
| Pattern* | GGA(mis2) | ||
| Repeat count | 6 | ||
| Method | PCR | ||
| Detection | |||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.