| Marker name | RSS0305 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | GTACCTCAACTGCTGGAGCC | |
| Rv | CGAACGCTTGCTTTTGATCT | ||
| EST/Genome sequences | RSCS06C07 | ||
| Map | GHRI | Linkage | LG7 |
| Position | 48.3 | ||
| SSR | Fragment size | 198 | |
| Pattern* | ATC(mis1) | ||
| Repeat count | 6 | ||
| Method | PCR | 60 | |
| Detection | Fragment analyzer | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.