Marker name | RSS0173 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | CTCAGGGAAACTCAAGCGAC | |
Rv | CATGTCGAGGGAGGGATAGA | ||
EST/Genome sequences | RSCS16M03 | ||
SSR | Fragment size | 134 | |
Pattern* | ACT(mis1) | ||
Repeat count | 9 | ||
Method | PCR | 60 | |
Detection | PAGE | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.