Azuki Marker Database

original sequence
>Contig123 
CTCCCGTCTTCCACGCCACCCCTCTGCACCAAATCCCCAAAACAGACGGCACCCTCAACG
ACTCCTCTTCAAAAACCATTTATTTCTCCTACCCCTCCCCCGCCACTTCCTTCATCTCCT
CCCTCACCGCCGACGCCCACACAAAACAACCCTCTTCCTCCTCGCCGCCCCCGCCTGCGC
CGGGTTCTTTCCACATCACCACTCTCTCCCACGTCTCATCCGCTGGGAAGCCTCCCCTCT
CCTCCTCCTCCTCTTTCAAGAGGAAGTGCAGCTCTGAGAACTTGCCTTCTGGAAAGTGCG
GTAGCTCCTCTAGCCGCTGTCATTGCTCCAAAAAGAGTAGGAAAATGAGGTTGAAGAAGG
TGGTGAGGGTACCGGCTATAAGCTTGAAGATGGCCGATATTCCACCGGATGATTATTCTT
GGAGGAAGTATGGACAGAAACCGATCAAAGGATCCCCTCATCCAAGGGGTTACTACAAGT
GCAGTAGCGTGAGAGGTTGTCCGGCGCGAAAGCATGTGGAGCGAGCTTTGGATGATCCGG
CTATGCTGGTGGTAACCTACGAGGGGGAGCACAGTCACACTCTCTCCGCGGCCGATGCCA
CTAACCTTATTCTTGAATCATCTTGAAGGTGGTACCCGTTACCAGGTGTATCGGAAACGC
AACCATTAATCGGGTTTACAAGATTTCAACGGGGTAATTATGGAGCTGTTGAATGCCAAC
TTTACTCTAGTCAGGGCACTAATCTCGAAAAAAATTAGTGGGGTGTTCCTTTTCCCTGTA
CAATATTATTGGATTCTTCTTACTTTTTTTTTCTCATTCTCTTCAAGGC


MarkerDB | Vigna angularis