Azuki Marker Database

original sequence
>Contig2299 
CTCAACACCACACCAAATTACTAGCCATTGCGCTAGTGCTCTGCGTTGCACTGTCCTTCG
CAAGGCCAACCCAAGGGAGGGTGCCCTTTGCATGCGACCCTAGGAACGGACTCACGAGGG
GGTTCAAGTTCTGCAACACCAACGTCCCCATCCACGTCAGGGTTCAGGACCTCATAGCCA
GACTCACATTGCCGGAGAAAATCAGGCTCGTGGTCAACAACGCCATCGCCGTGCCCAGGC
TCGGTATCCAAGGCTACGAGTGGTGGTCCGAGGCGCTTCACGGCGTCTCCAATGTGGGCC
CCGGCACCAAGTTTGGTGGGGCCTTCCCTGGCGCCACCATGTTCCCCCAAGTCATCACAA
CCGCTGCTTCCTTCAATCAATCTCTCTGGCGCCAAATCGGACGGGTGGTGTCTGATGAAG
CAAGAGCAATGTACAACGGTGGACAGGCTGGTTTGACGTATTGGAGTCCAAATGTCAACA
TTTTTCGCGACCCACGGTGGGGCCGCGGCCAAGAGACTCCCGGCGAAGACCCAACTCTCG
CCGCAAAATACGCCGCCAGCTATGTCCAAGGACTCCAAGGCGACGGCGCCGGAAACCGCC
TCAAGGTCGCTGCTTGTTGTAAACACTACACTGCCTATGACCTTGACAACTGGAATGGCG
TAGACAGGTTTCATTTCAATGCCAAGGTAAGCAAACAGGATCTGGAGGACACTTACGACG
TGCCATTTAAAGCCTGCGTGTTGGAAGGACAAGTGGCGAGTGTGATGTGTTCTTACAATC
AGGTGAATGGCAAGCCCACGTGTGCTGACCCTGATCTCCTTCGCAACACTATACGCGGCC
AATGGGGGCTCAATGGGTACATAGTCTCGGACTGTGACTCGGTTGGAGTTTTCTATGACA
ACCAACACTACACAAGAACACCCGAGGAGGCGGCAGCGGAGGCCATAAAAGCGGGCCTGG
ACTTGGACTGTGGCCCATTCTTGGCGATCCACACCGACGCTGCCATTAGGAAGGGACTCA
TTTCCGAAAACGATCTTAACCTTGCCTTGGCCAACCTTATCACGGTCCAAATGAGATTGG
GCATGTTCGACGGCGAACCCTCGGCCCAACCATACGGAAACTTGGGCCCAAGAGACGTGT
GCACCCCGGCCCATCAACAGCTGGCCCTTCAAGCAGCCAGAGAGAGCATAGTATTGTTAC
AAAACAAAAGAAACTCCTTACCACTATCTCCTGCGCGAATCCGCACCGTAGGAGTCATCG
GACCCAATTCGGACGCCACCGTTACAATGATAGGAAACTATGCTGGTGTGGCGTGTGGTT
ATACCAGTCCTTTGCAAGGGATTGCGAGGTATGTGAAGACTTCACATCAAGTTGGATGCA
GGAATGTGGCTTGTAGGGGAAACGAACTGTTCGGAGCAGCAGAGACCGTAGCTAAGCAAG
TTGACGCCACTGTGCTGGTAATGGGCCTTGACCAGTCCATAGAAGCAGAAACCAGAGATA
GACTTGGGCTTCTCTTACCAGGCCTCCAACAAGAGCTCGTTGCAAGGGTGGCTAGGGCCG
CCAGAGGCCCAGTCATCTTGGTTATCATGTCCGGTGGCCCAGTTGATGTCACGTTTGCGG
TGAATGACCCAAAGATCAGTGCCATTTTGTGGGTTGGCTATCCTGGTCAAGCTGGGGGAA
CTGCCATCGCTGACGTCATCTTTGGTCAAACTAACCCAGGAGGAAGATTACCCATGACAT
GGTACCCGGAAAAGTATTTGACTAAAGTACCCATGACAATCATGGACATGCGTCCAAACT
CAGCAACAGGGTACCCAGGAAGAACCTACAGATTCTACAAAGGACCTGTGGTGTTCCCAT
TCGGACATGGGTTAAGTTACTCGAGATTCAGCCAGAGCTTAGCCATTGCTCCAAAAGAGG
TGTCAGTGTCAGTGCCCTTAGCCACTCTCCAAGCCTTGACAAACTCAACCCTTTCAAGCG
AAGCAGTGAGGGTGAGCCACGCCAATTGTGATGATACATTGGAGATGGAATTCCACGTGG
ACGTGAAAAACGAAGGCTCCATGGATGGCACCCACACCCTTCTTGTATTCTCGAAACCAC
CACCTGGAAAATGGTCTCAGATCAAACAACTAGTGAACTTTCAGAAGACCCATGTTCCTG
CTGGGTCGAAGCAGCGTCTGAAGGTTGGTGTTCATGTCTGCAAACATTTGTCCGTCGTGG
ACCAGTTCGGGATTCGAAGAATCCCATCTGGTGAGCATGAACTCCACATAGGTGATCTCA
AACATTCTATTTCTGTCCAAACCGTGCAACAAATCAAGAACTGAAACATTCGTTCTGCCA
TTAAGTAATCATCTGTCAAGCAAGTTTGACAGCTCCAGCCAAGTTTTGCAAATAGCAAAA
ACATCATATGAAGTGTAAACAGAAAGAAAGATGTTACTATAATCTGTAAAATCAAATGTA
AAATAAGGATATATAGGTGACAACTGTAATTTGTAAACCATGTATCATTATTCATACTTC
ATATGTGCAAAAGGGGATTTAAAC


MarkerDB | Vigna angularis