Azuki Marker Database

VES1289 Information

Marker name VES1289
Marker category EST-SSR
Primer sequences Fw CCGTGAGTCAAACTTGCAGA
Rv GGGTGTGGGAAAACTCAGAA
EST/Genome sequences Contig1379
Lines
PIC Value
Lines 8
SNP Position
Method
SSR Fragment size 262
Pattern* GAGC
Repeat count 4
Method PCR TD
Detection 10% acrylamide
Multiplex
Gel image VES1281_1328.pptx [download]
Enzyme
Related markers Marker name
Species
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Vigna angularis